Mature sequence tae-miR1134

Accession numberMIMAT0005369
IDtae-miR1134
Stem-Loop tae-MIR1134
Sequence
caacaacaacaagaagaagaagau
Get sequence
Deep sequencing17 reads, 16 experiments

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).