Mature sequence hsa-miR-1224-3p

Accession numberMIMAT0005459
IDhsa-miR-1224-3p
Stem-Loop hsa-mir-1224
Sequence
ccccaccuccucucuccucag
Get sequence
Deep sequencing1776 reads, 69 experiments
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).