Mature sequence dme-miR-iab-8-3p

Accession numberMIMAT0005464
IDdme-miR-iab-8-3p
Previous IDsdme-miR-iab4as-3p;dme-miR-iab-4as-3p
Stem-Loop dme-mir-iab-8
Sequence
ggauacauucaguauacguuua
Get sequence
Deep sequencing114 reads, 13 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18172160 "A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands" Stark A, Bushati N, Jan CH, Kheradpour P, Hodges E, Brennecke J, Bartel DP, Cohen SM, Kellis M Genes Dev. 22:8-13(2008).