Accession | MIMAT0005485 |
Description | dme-miR-969-5p mature miRNA |
Hairpins | |
Sequence | GAGUUCCACUAAGCAAGUUUU |
Evidence |
experimental
454 [1], Illumina [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32397794 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31318925 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32397794 | |
involved_in | GO:0040017 positive regulation of locomotion |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:32397794 |