Mature sequence mml-miR-1226

Accession numberMIMAT0005579
IDmml-miR-1226
Stem-Loop mml-mir-1226
Sequence
ucaccagcccuguguucccuag
Get sequence
Deep sequencing9 reads, 3 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).