Mature sequence hsa-miR-1234-3p

Accession numberMIMAT0005589
IDhsa-miR-1234-3p
Previous IDshsa-miR-1234
Stem-Loop hsa-mir-1234
Sequence
ucggccugaccacccaccccac
Get sequence
Deep sequencing16 reads, 10 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).