Mature sequence ghr-miR162a

Accession numberMIMAT0005812
IDghr-miR162a
Stem-Loop ghr-MIR162a
Sequence
ucgauaaaccucugcauccag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).