Mature sequence hsa-miR-548j-5p

Accession numberMIMAT0005875
IDhsa-miR-548j-5p
Stem-Loop hsa-mir-548j
Sequence
aaaaguaauugcggucuuuggu
Get sequence
Deep sequencing4289 reads, 141 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).