Mature sequence hsa-miR-1304-5p

Accession numberMIMAT0005892
IDhsa-miR-1304-5p
Previous IDshsa-miR-1304
Stem-Loop hsa-mir-1304
Sequence
uuugaggcuacagugagaugug
Get sequence
Deep sequencing3610 reads, 110 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).