Mature sequence hsa-miR-1248

Accession numberMIMAT0005900
IDhsa-miR-1248
Stem-Loop hsa-mir-1248
Sequence
accuucuuguauaagcacugugcuaaa
Get sequence
Deep sequencing10907 reads, 125 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).