Mature sequence hsa-miR-1255a

Accession numberMIMAT0005906
IDhsa-miR-1255a
Stem-Loop hsa-mir-1255a
Sequence
aggaugagcaaagaaaguagauu
Get sequence
Deep sequencing5070 reads, 142 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).