Mature sequence hsa-miR-548n

Accession numberMIMAT0005916
IDhsa-miR-548n
Stem-Loop hsa-mir-548n
Sequence
caaaaguaauuguggauuuugu
Get sequence
Deep sequencing6392 reads, 153 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).