Mature sequence hsa-miR-548m

Accession numberMIMAT0005917
IDhsa-miR-548m
Stem-Loop hsa-mir-548m
Sequence
caaagguauuugugguuuuug
Get sequence
Deep sequencing161 reads, 61 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).