Mature sequence mdo-miR-1540a

Accession numberMIMAT0006139
IDmdo-miR-1540a
Stem-Loop mdo-mir-1540a
Sequence
ugauuccauagagcgcaugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1