Mature sequence mml-miR-496

Accession numberMIMAT0006358
IDmml-miR-496
Stem-Loop mml-mir-496
Sequence
ugaguauuacauggccaaucuc
Get sequence
Deep sequencing108 reads, 5 experiments
Predicted targets

References

1