Mature sequence mml-miR-544

Accession numberMIMAT0006408
IDmml-miR-544
Stem-Loop mml-mir-544
Sequence
auucugcauuuuuagcaaguuc
Get sequence
Deep sequencing48 reads, 5 experiments
Predicted targets

References

1