Mature sequence gga-miR-99a-3p

Accession numberMIMAT0006781
IDgga-miR-99a-3p
Previous IDsgga-miR-99a*
Stem-Loop gga-mir-99a
Sequence
caagcucgcuucuaugggucu
Get sequence
Deep sequencing4311 reads, 5 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
3
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).