Mature sequence oan-miR-29a-3p

Accession numberMIMAT0006807
IDoan-miR-29a-3p
Previous IDsoan-miR-29a
Stem-Loop oan-mir-29a-1 oan-mir-29a-2
Sequence
uagcaccauuugaaaucgguu
Get sequence
Deep sequencing56189 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).