Mature sequence oan-miR-302-3p

Accession numberMIMAT0007195
IDoan-miR-302-3p
Previous IDsoan-miR-302
Stem-Loop oan-mir-302-2 oan-mir-302-1
Sequence
uaagugcuuccauguuuuagu
Get sequence
Deep sequencing86 reads, 4 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).