Mature sequence gma-miR169b

Accession numberMIMAT0007356
IDgma-miR169b
Stem-Loop gma-MIR169b
Sequence
cagccaaggaugacuugccga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).