Mature sequence gma-miR1513a-5p

Accession numberMIMAT0007371
IDgma-miR1513a-5p
Previous IDsgma-miR1513
Stem-Loop gma-MIR1513a
Sequence
ugagagaaagccaugacuuac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2