Mature sequence gga-miR-1786

Accession numberMIMAT0007698
IDgga-miR-1786
Stem-Loop gga-mir-1786
Sequence
auucuuuucugcuguguuacu
Get sequence
Deep sequencing123 reads, 4 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).