Mature sequence gga-miR-1798-3p

Accession numberMIMAT0007714
IDgga-miR-1798-3p
Previous IDsgga-miR-1798
Stem-Loop gga-mir-1798
Sequence
ugguuuucagaaguguagcguu
Get sequence
Deep sequencing4 reads, 3 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).