Mature sequence aga-miR-1889

Accession numberMIMAT0007859
IDaga-miR-1889
Stem-Loop aga-mir-1889
Sequence
acacauuacagauugggauua
Get sequence
Deep sequencing reads, experiments

References

1