Mature sequence tca-miR-10-5p

Accession numberMIMAT0008357
IDtca-miR-10-5p
Previous IDstca-miR-10
Stem-Loop tca-mir-10
Sequence
uacccuguagauccgaauuugu
Get sequence
Deep sequencing reads, experiments
Database links
QuickGO function

References

1
PMID:18392875 "Analysis of the Tribolium homeotic complex: insights into mechanisms constraining insect Hox clusters" Shippy TD, Ronshaugen M, Cande J, He J, Beeman RW, Levine M, Brown SJ, Denell RE Dev Genes Evol. 218:127-139(2008).
2
3
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).