Mature sequence bta-miR-130b

• Accession number: MIMAT0009224
• ID: bta-miR-130b
• Stem-Loop: bta-mir-130b
• Sequence: cagugcaaugaugaaagggcau
• Deep sequencing: 16059 reads, 70 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-130b

References

1. PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3. PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).