Mature sequence bta-miR-433

Accession numberMIMAT0009318
IDbta-miR-433
Stem-Loop bta-mir-433
Sequence
aucaugaugggcuccucggugu
Get sequence
Deep sequencing263 reads, 52 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).