Mature sequence bta-miR-453

Accession numberMIMAT0009325
IDbta-miR-453
Stem-Loop bta-mir-453
Sequence
agguuguccguggugaguucgca
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).