Mature sequence mmu-miR-1953

Accession numberMIMAT0009424
IDmmu-miR-1953
Stem-Loop mmu-mir-1953
Sequence
ugggaaaguucucaggcuucug
Get sequence
Deep sequencing394 reads, 67 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).