Mature sequence mmu-miR-1970

Accession numberMIMAT0009444
IDmmu-miR-1970
Stem-Loop mmu-mir-1970
Sequence
ugugucacuggggauaggcuuug
Get sequence
Deep sequencing469 reads, 64 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).