Mature sequence bta-miR-376a

Accession numberMIMAT0009946
IDbta-miR-376a
Stem-Loop bta-mir-376a
Sequence
aucauagaggaaaauccacgu
Get sequence
Deep sequencing1293 reads, 65 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).