Mature sequence osa-miR2096-3p

Accession numberMIMAT0010057
IDosa-miR2096-3p
Stem-Loop osa-MIR2096
Sequence
ccugaggggaaaucggcggga
Get sequence
Deep sequencing5 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).