Mature sequence gma-miR1508b

Accession numberMIMAT0010081
IDgma-miR1508b
Stem-Loop gma-MIR1508b
Sequence
uagaaagggaaauagcaguug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).