Mature sequence aga-miR-957

Accession numberMIMAT0010106
IDaga-miR-957
Stem-Loop aga-mir-957
Sequence
ugaaaccguccaaaacugaggc
Get sequence
Deep sequencing reads, experiments

References

1
" Griffiths-Jones S Unpublished (2009).