Mature sequence ebv-miR-BART21-5p

Accession numberMIMAT0010130
IDebv-miR-BART21-5p
Stem-Loop ebv-mir-BART21
Sequence
ucacuagugaaggcaacuaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
2
PMID:19881953 "Modulation of LMP2A expression by a newly identified Epstein-Barr virus-encoded microRNA miR-BART22" Lung RW, Tong JH, Sung YM, Leung PS, Ng DC, Chau SL, Chan AW, Ng EK, Lo KW, To KF Neoplasia. 11:1174-1184(2009).