Mature sequence sja-miR-125b

Accession numberMIMAT0010179
IDsja-miR-125b
Stem-Loop sja-mir-125b
Sequence
ucccugagacugauaauugcuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).