Mature sequence sma-miR-125a-5p

Accession numberMIMAT0010183
IDsma-miR-125a-5p
Previous IDssma-miR-125a
Stem-Loop sma-mir-125a
Sequence
ucccugagacccuuugauugcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).