Mature sequence bta-miR-376d

Accession numberMIMAT0010199
IDbta-miR-376d
Stem-Loop bta-mir-376d
Sequence
aucauagaggaaaauccacau
Get sequence
Deep sequencing1243 reads, 65 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).