Mature sequence mtr-miR164d

Accession numberMIMAT0011103
IDmtr-miR164d
Stem-Loop mtr-MIR164d
Sequence
uggagaagcagggcacaugcu
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).