Mature sequence osa-miR2118l

Accession numberMIMAT0011751
IDosa-miR2118l
Stem-Loop osa-MIR2118l
Sequence
uuccuaaugcuucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).