Mature sequence osa-miR2118m

Accession numberMIMAT0011752
IDosa-miR2118m
Stem-Loop osa-MIR2118m
Sequence
uuccugaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).