Mature sequence zma-miR2118d

Accession numberMIMAT0011763
IDzma-miR2118d
Stem-Loop zma-MIR2118d
Sequence
uuccugaugccucccaugccua
Get sequence
Deep sequencing37 reads, 13 experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).