Mature sequence zma-miR2118g

Accession numberMIMAT0011766
IDzma-miR2118g
Stem-Loop zma-MIR2118g
Sequence
uuccugaugccuccuauuccua
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).