Mature sequence zma-miR2275c-5p

Accession numberMIMAT0011771
IDzma-miR2275c-5p
Stem-Loop zma-MIR2275c
Sequence
aggauuagagggacuugaacc
Get sequence
Deep sequencing581 reads, 160 experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).