Mature sequence bdi-miR1139

Accession numberMIMAT0012177
IDbdi-miR1139
Stem-Loop bdi-MIR1139
Sequence
gaguaacauacacuaguaaca
Get sequence
Deep sequencing reads, experiments

References

1