Mature sequence bdi-miR1122

Accession numberMIMAT0012183
IDbdi-miR1122
Stem-Loop bdi-MIR1122
Sequence
uagauacauccguauuugga
Get sequence
Deep sequencing reads, experiments

References

1