Mature sequence bdi-miR437

Accession numberMIMAT0012188
IDbdi-miR437
Stem-Loop bdi-MIR437
Sequence
gaacuuagagaaguuugacuu
Get sequence
Deep sequencing reads, experiments

References

1