Mature sequence eca-miR-30e

Accession numberMIMAT0012916
IDeca-miR-30e
Stem-Loop eca-mir-30e
Sequence
uguaaacauccuugacuggaag
Get sequence
Deep sequencing25995 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).