Mature sequence eca-miR-28-3p

Accession numberMIMAT0013093
IDeca-miR-28-3p
Stem-Loop eca-mir-28
Sequence
cacuagauugugagcuccugga
Get sequence
Deep sequencing34573 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).