Mature sequence eca-miR-136

Accession numberMIMAT0013128
IDeca-miR-136
Stem-Loop eca-mir-136
Sequence
acuccauuuguuuugaugaugg
Get sequence
Deep sequencing2809 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).